Music travels through space and time, undergoing mutations on its way. The close connection between music and media is like that between transmission and recording, and can be thought of as genes and DNA. As a musician, Yakushimaru has worked in a variety of genres from pop to experimental music and has created various types of artwork such as drawings, installations, pieces that make use of satellite and biometric data, a song-generating robot, original instruments, and more.

In l’m Humanity, Yakushimaru makes pop music with the use of the nucleic acid sequence of Synechococcus, which is a type of cyanobacteria. The musical information is converted into a genetic code, which was used to create a long DNA sequence comprising three con-nected nucleic acid sequences. The DNA was artificially composited and incorporated into the chromosomes of the microorganism. This genetically-modified microorganism with mu-sic in its DNA is able to continuously self-replicate. So even if humanity as we know it becomes extinct, it will live on, waiting for the music within it to be decoded and played by the species that replaces humanity.

When thinking about the lifespan of recording media, for example, CDs are said to last for decades and acid-free paper is said to last for centuries. In comparison, DNA’s lifespan as a recording media is 500 thousand years, physicochemically speaking. Because the lifespan of DNA is so long, it has great potential as a recording media.

Biotechnical procedures

In our DNA, which consists of four kinds of nucleotides (A, C, G and T), each amino acid is encoded into a distinct nucleotide triplet. The rules for translation are summarized in the codon table. A cipher to convert the music chords into genetic codes was created based on this codon table used in living cells. The main chord progression of I’m Humanity was converted into the following 276 nucleotides:

I’m Humanity: 276bp; A 22; T 101; G 57; C; 96 (GC content = 55.4%)

GGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGG TCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATTCTTCTGGAGGATCTTCTGGAGGATCTTCTTT-GGGTTCTTCTGGAGGCGGTCTTCCCCATGGTCTTCCCCATCTTCTTCTTCTTGGTGGTGGTGG-TATTCTTCTTCTCGGTGGTCCCAC-TGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCAT

The genetic code was artificially synthesized by a DNA synthesizer and inserted in a vector, designated pSyn_1. The inserted DNA fragment encoded music chords was introduced to a genome of a host cell (a cyanobacterium, Synechococcus elongatus PCC 7942) by homolo-gous recombination. The music chords in the Synechococcus genome can be infinitely re-produced along with cell division.

“I’m Humanity” genetically-modified microorganism

Etsuko Yakushimaru with “I’m Humanity” in culture

On the other hand, it is not rare for nucleic acid sequences to mutate, and naturally this leads to changes in the genetic information. In that respect, in the history of “diffusion of music,” in which “mutation” has also had an important role in addition to “transmission” of information, the uniqueness of the “mutation” of nucleic acid sequences was strikingly similar.

In the lyrics of I’m Humanity, the microorganism I’m Humanity sings “Stop the evolution―don’t stop it.” Although mutation spurs evolution, it also means the changing of a species. Perhaps I’m Humanity is caught between its own evolution and its fear that its evolving could mean the loss of nucleic acid sequences with musical information, which would make it impossible for I’m Humanity to sing the song anymore.

The transposon (the genes that transfer on the genome and cause mutation) based on the DNA of Synechococcus, was planted in the score of “I’m Humanity”. In this performance, that segment was performed in an arragement to make it seem like actual mutatuin was taking place.
I’m Humanity became the first song in human history to be released in the three formats of “digital music distribution,” “CD,” and “genetically-modified microorganism.” This song, produced with the use of biotechnology, was distributed as pop music and also made it on the Apple Music start page.

Credits

l’m Humanity produced and directed by Etsuko Yakushimaru

Lyrics: Tica Alpha (a.k.a Etsuko Yakushimaru)
Music: Tica Alpha (a.k.a Etsuko Yakushimaru)
Genetic Codes: Etsuko Yakushimaru
Art Direction & Drawing & Design: Etsuko Yakushimaru
(C) 2016 Yakushimaru Etsuko

Musical arrangement: Etsuko Yakushimaru, Motoki Yamaguchi
Vocal & Chorus & Programming & dimtakt: Etsuko Yakushimaru
Drums & Programming: Motoki Yamaguchi
Recording & Mixing Engineer: Yujiro Yonetsu
Mastering Engineer: Shigeo Miyamoto
Technical Support: Satoshi Hanada
Photograph & Movie: MIRAI seisaku / Photograph(Compact Disc): Satomi Haraguchi
Label: MIRAI records
(P) MIRAI records
Support & Thanks: KENPOKU ART 2016, METI Ministry of Economy, Trade and lndustry., National Institute of Technology and Evaluation (NITE), Satoshi Hanada, Tokyo Metropolitan University, FabCafe MTRL, Yamaguchi Center for Arts and Media [YCAM]
*Apple Music is a trademark of Apple Inc., registered in the U.S. and other countries.

About the artist

Etsuko Yakushimaru (JP) is an artist, musician, producer, lyricist, composer, arranger, and vocalist. Broadly active, from pop music to experimental music and art. Consistently independent in her wide-ranging activities, which also include drawing, installation art, media art, poetry and other literature, and recitation. Producing numerous projects and artists, including her band, Soutaiseiriron. While appearing in the music charts with many hit songs, she has also created a project that involved the use of satellite, biological data and biotechnology, a song-generating robot powered by artificial intelligence and her own voice, an independently-developed VR system, and original electronic musical instruments. Major recent activities include exhibitions at Mari Art Museum, Toyota Municipal Museum of Art, KENPOKU ART 2016, and Yamaguchi Center for Arts and Media [YCAM]. Her Tensei Jingle and Flying Tentacles albums, both released in 2016, received praise from figures including Ryuichi Sakamoto, Jeff Mills, Fennesz, Penguin Cafe, Kiyoshi Kurosawa and Toh EnJoe.

Read more: starts-prize.aec.at.

This project is presented in the framework of the STARTS Prize 2017. STARTS Prize received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No 732019.

The holes and stains in the dress have been patched with silk stained with pink colonies of E. coli bacteria, grown on dye-containing agar. The genomes of these bacteria have been edited using a technique called CRISPR, to remove an ampicillin antibiotic resistance gene and scarlessly patch the break using homologous recombination with a fragment of DNA encoding the WWII slogan Make Do and Mend. Ampicillin is part of the penicillin group of antibiotics, so with this artistic genomic edit, Dumitriu and Goldberg have used today’s technology to return the organism to its pre-antibiotic era state, reflecting on how we might in future control and protect such biotechnological advances.

Credits

Supported by the FEAT project, an initiative of eutema GmbH (AT), Stichting Waag Society (NL), and youris.com (BE). lt has received funding from the European Union’s Horizon 2020 Research and Innovation programme under grant agreement No 686527 (H2020-FETOPEN- 2015-CSA). Made in collaboration with Dr Sarah Goldberg at the Synthetic Biology Laboratory for the Decipherment of Genetic Codes at the Technion in Israel. With assistance from Dr Heather Macklyne, University of Sussex, and Dr Rob Neely, University of Birmingham.

About the artist

Anna Dumitriu (UK) (1969) is a British artist whose work fuses craft, sculpture, and Bio Art to explore our relationship to the microbial world, medicine, and technology. She is affiliated to the Modernising Medical Microbiology Project at the University of Oxford (UK), the Department of Computer Science at The University of Hertfordshire (UK), Brighton and Sussex Medical School (UK), and Waag Society (Netherlands). She is the artist partner on the EU Horizon 2020 funded FET support action FEAT: Future Emerging Art and Technology and is working with MRG-Grammar to explore gene regulation.

Read more: starts-prize.aec.at.

This project is presented in the framework of the STARTS Prize 2017. STARTS Prize received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No 732019.

Edunia expresses Kac’s DNA exclusively in its red veins. The gene that Kac has selected is responsible for the identification of foreign bodies. In this work, it is precisely what identifies and rejects the Other that the artist integrates into the Other, thus creating a new kind of self that is partly flower and partly human.

Credits

www.ekac.org

Join us for an interesting talk, discussion and hands-on experience on how to build your own bio-display and hear about our workshops, projects and curriculum for biodesign at the Royal College of Art.

Biology today is like computing in the late 1980s, simply awaiting an explosion of innovation. Technologies are developing faster than ever but some key platform technologies are still missing. People need to be able to access biology at an affordable price, in their own homes or workplaces and without enormous infrastructure.

This exhibit shows a personal bio-computer. Users can build simple biologic platforms that can be used to make, create and build with life itself.

The audience exposed to visually enticing experiments will become part of the artwork. The responses of viewers attempting to piece together the narrative of experiments will be captured and integrated into the visuals and soundscape, gradually adding to the interpretation of activities. The laboratory will feature ongoing experiments such as in vitro fertilization of sea urchins, DNA manipulation, column chromatography of blood lysate, thale cress somatic embryogenesis and light-directed manipulation of the protozoan euglena, and will combine with algorithmic processing.

Credits

Authors: Roland van Dierendonck (NL), Špela Petrič (SI), Günter Seyfried (AT), Miha Turšič (SI), Slavko Glamočanin (SI)

Production: Waag Society (NL)
Support: Future Emerging Art and Technology, Ars Electronica

The saliva samples collected from visitors are first mixed, and then the segments from their DNA that almost all people have in common are extracted and amplified. This collective DNA is then prepared so that it produces clearly recognizable images – symbolic visualizations of our common identity. With this playful and radical appropriation of molecular and bio-informative tools by art, Paul Vanouse seeks to inform us about the use, the application, and the public perception of this technology and to make us more aware of this issue.

Credits

www.paulvanouse.com/ap

The protagonist Helen Fares begins her search at the Ars Electronica Futurelab, gets acquainted with virtual friends, learns to steer a drone with her brain and to hack her own DNA. Encounters with experts in the US, Japan and Britain provide additional international context to the posed question: What insights does Helen derive from her journey through futuristic technologies? Are we Homo Digitalis evolving into a new species: Homo Digitalis?

Homo Digitalis is simultaneously a scientific experiment. In cooperation with the Fraunhofer Institute, BR, ARTE and ORF developed a playful test: How long do you still have as a human being? Find out with our Homo Digitalis Chatbot or at www.homodigitalis.tv!

Credits

Directors: Christiane Miethge, Nils Otte
Host: Helen Fares
Camera: Kyrill Ahlvers, Tenzin Sherpa
Sound: Gidon Lasch, Nils Otte
Editors: Tim Sprado, Daniel Bluhm
Animation and graphics: Anna Hunger, Sven Schulz
Illustrations: Benny Nero
Programming: Bernd Paulus, Phuoc Le, Lena Fischer
Producer, Web series: Andreas Martin
Producer, online test: Miriam Mogge
Production director: Laura Sages
Creative director: Christiane Miethge
Scientific director: Kathrin Pollmann
Team Ars Electronica Futurelab: Christopher Lindinger, Martina Mara, Maria Pfeifer, Roland Aigner, Clemens Francis Scharfen, Peter Holzkorn, Michael Platz, Nicole Grüneis, Peter Freudling, Erika Jungreithmayr, Manuel Selg
Producers: Dietmar Lyssy, Marcus Uhl

Editor, BR: Thomas Sessner
Editors, ARTE: Katja Ferwagner, Katja Dünnebacke, Aurélie Marx
Editor, ORF: Robert Glashüttner, Siegfried Steinlechner

Produced by Bilderfest GmbH and BR—Bavarian Broadcasting; co-produced by ARTE and the ORF—Austria Broadcasting Company.

Thanks to Fraunhofer Institute, IAO and the Ars Electronica Futurelab