Music travels through space and time, undergoing mutations on its way. The close connection between music and media is like that between transmission and recording, and can be thought of as genes and DNA. As a musician, Yakushimaru has worked in a variety of genres from pop to experimental music and has created various types of artwork such as drawings, installations, pieces that make use of satellite and biometric data, a song-generating robot, original instruments, and more.

In l’m Humanity, Yakushimaru makes pop music with the use of the nucleic acid sequence of Synechococcus, which is a type of cyanobacteria. The musical information is converted into a genetic code, which was used to create a long DNA sequence comprising three con-nected nucleic acid sequences. The DNA was artificially composited and incorporated into the chromosomes of the microorganism. This genetically-modified microorganism with mu-sic in its DNA is able to continuously self-replicate. So even if humanity as we know it becomes extinct, it will live on, waiting for the music within it to be decoded and played by the species that replaces humanity.

When thinking about the lifespan of recording media, for example, CDs are said to last for decades and acid-free paper is said to last for centuries. In comparison, DNA’s lifespan as a recording media is 500 thousand years, physicochemically speaking. Because the lifespan of DNA is so long, it has great potential as a recording media.

Biotechnical procedures

In our DNA, which consists of four kinds of nucleotides (A, C, G and T), each amino acid is encoded into a distinct nucleotide triplet. The rules for translation are summarized in the codon table. A cipher to convert the music chords into genetic codes was created based on this codon table used in living cells. The main chord progression of I’m Humanity was converted into the following 276 nucleotides:

I’m Humanity: 276bp; A 22; T 101; G 57; C; 96 (GC content = 55.4%)

GGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGG TCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATTCTTCTGGAGGATCTTCTGGAGGATCTTCTTT-GGGTTCTTCTGGAGGCGGTCTTCCCCATGGTCTTCCCCATCTTCTTCTTCTTGGTGGTGGTGG-TATTCTTCTTCTCGGTGGTCCCAC-TGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCATGGTCTTCCCCAT

The genetic code was artificially synthesized by a DNA synthesizer and inserted in a vector, designated pSyn_1. The inserted DNA fragment encoded music chords was introduced to a genome of a host cell (a cyanobacterium, Synechococcus elongatus PCC 7942) by homolo-gous recombination. The music chords in the Synechococcus genome can be infinitely re-produced along with cell division.

“I’m Humanity” genetically-modified microorganism

Etsuko Yakushimaru with “I’m Humanity” in culture

On the other hand, it is not rare for nucleic acid sequences to mutate, and naturally this leads to changes in the genetic information. In that respect, in the history of “diffusion of music,” in which “mutation” has also had an important role in addition to “transmission” of information, the uniqueness of the “mutation” of nucleic acid sequences was strikingly similar.

In the lyrics of I’m Humanity, the microorganism I’m Humanity sings “Stop the evolution―don’t stop it.” Although mutation spurs evolution, it also means the changing of a species. Perhaps I’m Humanity is caught between its own evolution and its fear that its evolving could mean the loss of nucleic acid sequences with musical information, which would make it impossible for I’m Humanity to sing the song anymore.

The transposon (the genes that transfer on the genome and cause mutation) based on the DNA of Synechococcus, was planted in the score of “I’m Humanity”. In this performance, that segment was performed in an arragement to make it seem like actual mutatuin was taking place.
I’m Humanity became the first song in human history to be released in the three formats of “digital music distribution,” “CD,” and “genetically-modified microorganism.” This song, produced with the use of biotechnology, was distributed as pop music and also made it on the Apple Music start page.

Credits

l’m Humanity produced and directed by Etsuko Yakushimaru

Lyrics: Tica Alpha (a.k.a Etsuko Yakushimaru)
Music: Tica Alpha (a.k.a Etsuko Yakushimaru)
Genetic Codes: Etsuko Yakushimaru
Art Direction & Drawing & Design: Etsuko Yakushimaru
(C) 2016 Yakushimaru Etsuko

Musical arrangement: Etsuko Yakushimaru, Motoki Yamaguchi
Vocal & Chorus & Programming & dimtakt: Etsuko Yakushimaru
Drums & Programming: Motoki Yamaguchi
Recording & Mixing Engineer: Yujiro Yonetsu
Mastering Engineer: Shigeo Miyamoto
Technical Support: Satoshi Hanada
Photograph & Movie: MIRAI seisaku / Photograph(Compact Disc): Satomi Haraguchi
Label: MIRAI records
(P) MIRAI records
Support & Thanks: KENPOKU ART 2016, METI Ministry of Economy, Trade and lndustry., National Institute of Technology and Evaluation (NITE), Satoshi Hanada, Tokyo Metropolitan University, FabCafe MTRL, Yamaguchi Center for Arts and Media [YCAM]
*Apple Music is a trademark of Apple Inc., registered in the U.S. and other countries.

About the artist

Etsuko Yakushimaru (JP) is an artist, musician, producer, lyricist, composer, arranger, and vocalist. Broadly active, from pop music to experimental music and art. Consistently independent in her wide-ranging activities, which also include drawing, installation art, media art, poetry and other literature, and recitation. Producing numerous projects and artists, including her band, Soutaiseiriron. While appearing in the music charts with many hit songs, she has also created a project that involved the use of satellite, biological data and biotechnology, a song-generating robot powered by artificial intelligence and her own voice, an independently-developed VR system, and original electronic musical instruments. Major recent activities include exhibitions at Mari Art Museum, Toyota Municipal Museum of Art, KENPOKU ART 2016, and Yamaguchi Center for Arts and Media [YCAM]. Her Tensei Jingle and Flying Tentacles albums, both released in 2016, received praise from figures including Ryuichi Sakamoto, Jeff Mills, Fennesz, Penguin Cafe, Kiyoshi Kurosawa and Toh EnJoe.

Read more: starts-prize.aec.at.

This project is presented in the framework of the STARTS Prize 2017. STARTS Prize received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No 732019.

Edunia expresses Kac’s DNA exclusively in its red veins. The gene that Kac has selected is responsible for the identification of foreign bodies. In this work, it is precisely what identifies and rejects the Other that the artist integrates into the Other, thus creating a new kind of self that is partly flower and partly human.

Credits

www.ekac.org

The artist creates symbolic points of connection, to make a symbolic action – in other words, the co-evolution between a human and a dog has been used as a matrix for the question: what in the ecologically ruined, over populated and economically compromised world defines humans as a superior species?

Ecce Canis

In the Ecce Canis, the artist explores a parallel evolution between a wolf, human and a dog, and as a result of the research composes a spherical cave where the visitors could smell the serotonin based odor, extracted out of the platelets of her and her dog companion Byron, since living with dogs for thousands of years turned out to be one of the parameters for the mutation of the gene SLC6A4, that regulates the serotonin transporter in humans.

I Hunt Nature And Culture Hunts Me

The interspecies collaboration resulted in the performance I Hunt Nature And Culture Hunts Me (created during a residency in the French JACANA Wildlife Studios). Starting from the phylogenetics (study of the evolutionary history of an organism) and continuing into an ethology (the scientific and objective study of animal behaviour) of a wolf, it revolves around the relationship between wolf, dog, and human.

Hybrid Family

The project Hybrid Family thematizes the social and ideological instrumentalization of the female body and breastfeeding. For three months Maja Smrekar was submitted to a specific living conditions (a diet and a mechanical stimulation) to promote lactation. A side effect of this process was the production of the hormone oxytocin, which plays an important role in fostering trust and empathy between mother and child and consequently towards the society as a whole. The artist was able to observe this in her interaction with her dog.

ARTE_mis

ARTE_mis is the fourth and mostly discussed project in the series. A reproductive cell from the artist was denucleated and the genetic material (the DNA) was removed from the cell. The denucleated cell then served as a host for an extracted body cell from her dog companion Ada. Both cells were fused together. The result is not to be equated with a fertilization, but rather a hybrid cell was created, even though it is not capable of further development. Therefore the artist symbolically placed the cell materials in an equal cohabitation relationship as an artistic artefact.

Despite the fact that the project carries a plethora of biotechnological potentials, it at the same time primarily serves as a civil tactical media that evokes a public discourse and serves as a reference to think beyond humanist limitations in order to embrace the risks that becoming-other-than human bring in the future.

Credits

www.majasmrekar.org

The MDS was used, for example, to create the 30-day Simit Diet: different strands of wild yeast from people from various parts of Istanbul are combined with transgenic organisms that can produce vitamins, flavors and smells, and the mixed into the dough of the traditional Turkish simit pastries. This way a completely new simit with different characteristics was made every day.

The MDS is intended not only to present a new, progressive technology, but also to raise the question of how we want to design ourselves, our lives and life around us.

Credits

www.biorealize.com

The saliva samples collected from visitors are first mixed, and then the segments from their DNA that almost all people have in common are extracted and amplified. This collective DNA is then prepared so that it produces clearly recognizable images – symbolic visualizations of our common identity. With this playful and radical appropriation of molecular and bio-informative tools by art, Paul Vanouse seeks to inform us about the use, the application, and the public perception of this technology and to make us more aware of this issue.

Credits

www.paulvanouse.com/ap

The key resource in this value production is the genetic material acquired from individuals through exploitable commercial services to be resold as digitized genetic data to research institutions for profit.

The Waag Society decided to challenge this exploitation with a socially responsible business model of self-ownership, where citizens remain owners of their genetic material and sequenced data. For that purpose the Waag Society proposes a cooperative institution, fully owned by its members, providing a legal framework for citizens to remain owners of their genetic data during the whole process of its monetization. Such an organization will actively advocate, negotiate and represent citizen interests.

Credits

Production: Waag Society (NL)
Support: Creative Industries Fund NL

Waag Society (NL) is an institute for art, science and technology—is a pioneer in the field of digital media. Over the past 22 years, the foundation has developed into an institution of international stature, a platform for artistic research and experimentation, and has become both a catalyst for events and a breeding ground for cultural and social innovation. Waag Society explores emerging technologies and provides art and culture a central role in the designing of new applications for novel advances in science and technology.

www.waag.org/en/project/gene-coop

The protagonist Helen Fares begins her search at the Ars Electronica Futurelab, gets acquainted with virtual friends, learns to steer a drone with her brain and to hack her own DNA. Encounters with experts in the US, Japan and Britain provide additional international context to the posed question: What insights does Helen derive from her journey through futuristic technologies? Are we Homo Digitalis evolving into a new species: Homo Digitalis?

Homo Digitalis is simultaneously a scientific experiment. In cooperation with the Fraunhofer Institute, BR, ARTE and ORF developed a playful test: How long do you still have as a human being? Find out with our Homo Digitalis Chatbot or at www.homodigitalis.tv!

Credits

Directors: Christiane Miethge, Nils Otte
Host: Helen Fares
Camera: Kyrill Ahlvers, Tenzin Sherpa
Sound: Gidon Lasch, Nils Otte
Editors: Tim Sprado, Daniel Bluhm
Animation and graphics: Anna Hunger, Sven Schulz
Illustrations: Benny Nero
Programming: Bernd Paulus, Phuoc Le, Lena Fischer
Producer, Web series: Andreas Martin
Producer, online test: Miriam Mogge
Production director: Laura Sages
Creative director: Christiane Miethge
Scientific director: Kathrin Pollmann
Team Ars Electronica Futurelab: Christopher Lindinger, Martina Mara, Maria Pfeifer, Roland Aigner, Clemens Francis Scharfen, Peter Holzkorn, Michael Platz, Nicole Grüneis, Peter Freudling, Erika Jungreithmayr, Manuel Selg
Producers: Dietmar Lyssy, Marcus Uhl

Editor, BR: Thomas Sessner
Editors, ARTE: Katja Ferwagner, Katja Dünnebacke, Aurélie Marx
Editor, ORF: Robert Glashüttner, Siegfried Steinlechner

Produced by Bilderfest GmbH and BR—Bavarian Broadcasting; co-produced by ARTE and the ORF—Austria Broadcasting Company.

Thanks to Fraunhofer Institute, IAO and the Ars Electronica Futurelab

SAT Sept. 9, 2017

SAT Sept. 9, 2017, 11:00 AM-12:30 PM

Infos

Meeting Point: POSTCITY WE GUIDE YOU Meeting Point
Duration: 90 minutes
Language: English
Price: € 16 / € 12 reduced